Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST252026
Clone ID OST252026
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST252026
Sequence
ACTGAGGTGCGCTCAAGGAGGAATTTGAGAAGAATAAGGGCAAAGGTTTCAGCGTGGTGGCAGACACGCCTGAGCTGCAG
AGAATCAAGAAGACCCAGGACCAGATCAGCAATGTGAGANCCTGCCCTGANGCCNAGNNTACCCTCTGGNCTCCCTTNNN
ATCGCTATGGGTGNNNACCCTCAAGCAGAGGCCNACCGCCAGGACAGGNCANATCACAGGCAAGNGNNGAGNGANTTGAG
GTACCCNGGCNCACTNTANTTTGTNCNCCCTCTTTGGTGGNCACTCTGCCCAAATGGCATTTNNTGACTTAAAGANNATG
GTGTTTTCAAGGNNNACAGATNNNCTGNCTTCTCCANNGCAATGCCCCAGGNGGCGGTGGGAAACGGTACCGTGCAGTGN
ATGANTACAGCGCTGCCGACGAGGACGAGGTCTCCTTCCAGGATGGGGACACCATCGTCAATGTGCAGCAGATCGATGAC
GGCTGGATGTACGGGACCGTAGAGCGCACCGGTGACACGGGGATGCTGCCAGCCAACTACGTGGGAGGCCATCTGAACCC
Sequence Type mRNA
Unitrap ID UNI8858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97686154..97697563 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es