Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST251924
Clone ID OST251924
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST251924
Sequence
ACTGAGCTGTAGCATTTGCAAGAAGAAGCAGCAACAGTACACTTCATTGTTCCAGCTTCTCGGTTCAAACTCCTGAAGGG
NGCTGANAGCATAACCACATACACCTTTAACACGCACAAAGCCCAGCACACCTTCTGCAAGAGATGTGGTGTCCATGAGC
TTCTATACTCCGCGCGTCCAACCCCGGGGGCTTTGGAATCGCCCCCCACCTGCCTGGACGAAGGCACTGTGCGGAGTGNG
GTCACTGAGGAGTTCAATGGCAGTGACTGGGAACGAGCCATGAAGGAGCACAAGACCATCAAGAACATGTCAAAGGAGTG
AGCAGGGCANGTAGCCCTTGNAGGTTGCATGGGTGTGTGT
Sequence Type mRNA
Unitrap ID UNI22686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62338628..62347458 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es