Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST251725
Clone ID OST251725
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST251725
Sequence
GAACTGAGCCTCCCTGAAGGAGCACCCTCGGNCCACACTTCTGTCTGATGGCAGCAGCCCAGCTCCTTCCAGGAATGTCG
GCATGACCATCTCTCAGAAAGGGGGTCTCCAGCCAACACCGAGCCCAGCTGGATCTGGGGTGCCGACTTGGGGTCCCGCA
AGCAGGTGGTGAACATCCCATCCTTTATTGTTCGCCTGGACTCGCAGAAGCACATCGACTTCTCCCTCCGTTCTCCTTAT
GGTGGCGGCCGTCCAGGCCGAGTGAAGAGGAAGAATGCCAAGAAAGGCCAGGGCGGGGCTGGAGCTGGTGATGATGAGGA
AGAGGATTAATTCTTGGCTGAACTGGAGGATTGTCTAGTTTTCCAGCTGAAAAATAAAAAA
Sequence Type mRNA
Unitrap ID UNI23611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3550337..3658485 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006333 (Rps9) NM_029767 ribosomal protein S9 Gene [Source:MGI (curated);Acc:Rps9-001]

 
Come back to gene ENSMUSG00000006333


For any suggestions or comments, please send an email to unitrap@crg.es