Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST251724
Clone ID OST251724
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST251724
Sequence
TGAGGTGTTGTGTGGATTTACTCTCCAGCTCATTACACACTGCAGTAATACAGTTATGGCGGCTTTCCAGCCCCTCAGGA
GTAGTCACCTAAAGAGCAAAGCGTCTGTCCGAAAAGTAAGTCCTTGTCTTAGGTTCCTCTCAGTGGGACTTTAAAAANAT
GTGCGGTNTGGNTTTTTAGAGTTTTTAAATGAATCTTAGTATTTATGGAAATTATAACATTAAAATACTATGAAGGCGAA
CGTGTAAAA
Sequence Type mRNA
Unitrap ID UNI23612

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 78922268..78922511 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075507 (AC161608.5)  

 
Come back to gene ENSMUSG00000075507


For any suggestions or comments, please send an email to unitrap@crg.es