Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA022
Clone ID YTA022
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA022
Sequence
CTTTAGGCTGCTCGTGAACAAGGGCACTGGTCGGTTTAGCGTCCTCCGCTCGAGTGCCTACCGCCGCTTCGTCGAGAGCC
CGCGCAGGATCCAAGACACTTTGCAAACATGGAGACTGTCGTTCGCCGATGCCCATTCTTATCCCGAGTCCCTCAGGCCT
TTCTGCAGAAGGCAGGAAAGTCTCTGTTGTTCTATGCTCAAAACTGCCCCAAGATGATGGAAGTTGGGGCCAAGCCAGCT
CCTCGAACCCTGTCCACATCAGCTGTCCACTGCCAGCAGGTCAAAGAAACCCCTCCAGCCAATGAGAAAGAGAAAACTGC
CAAGGCCGCAGTCCAGCAGGCTCCTGACGAGTCCCAGATGGCACAGACTCCAGACGGCACACAGCTCCCGTCTGGACACC
CGTCCCCTGCTACAAGCCAGGGCTCTGGGAGCAAGTGCCCTTTCCTGGCAGCACAGCTGAGCCAGACAGGCAGCAGCGTC
TTCCGCAAGGCCAGTCTGGAGCTCCAGGAGGACGTGCAGGAAATGCATGCTGTGAGGAA
Sequence Type mRNA
Unitrap ID UNI5492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106145495..106150200 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032786 (Alas1) NP_065584 aminolevulinic acid synthase 1 Gene [Source:MGI Symbol;Acc:MGI:87989]

 
Come back to gene ENSMUSG00000032786


For any suggestions or comments, please send an email to unitrap@crg.es