Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA056
Clone ID YTA056
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA056
Sequence
AGGAATGCCTCAAACAGTCAAAACTCAGGCCAAAGTTTACCTTCTATGATGGGCCTCCCTTTGCTACTGGACTGCCTCAC
TATGGACACATACTTGCTGGGACAATCAAAGATATCGTTACGAGATACGCTCACCAGAGCGGGTTTCACGTTGACAGAAG
ATTCGGGTGGGACTGTCACGGCTTACCTGTGGAGTACGAAATCGATAAGACACTGGGCATCAAAGGCCCGGAGGATGTGG
CCAAAATGGGGATTGCAGAGTACAACAAGCAGTGCCGAGCAATCGTGATGAGATACTCCGCTGAGTGGAAGTCTACTGTT
ACCAGACTCGGCCGATGGATCGACTTTGACAATGACTACAAAACACTATACCCACAGTTCATGGAATCAGTCTGGTGGGT
CTTCAAGCAGCTGTATGACAAAGGCCTCGTGTACAGAGGCGTGAAGGTCATGCCCTTCTCCACCGCGTGTGGCACTCCAC
TCTCCAACTTCGAATCTAACCAGAATTACAAGGATGTTCAGGATCCCTCAGTATTTGTAACATTCCCTTTGGAGGAAGAT
GAAAATACATCCTTAGTTGCTTGGACAACCACTCCTTGGACTCTACCCAGTAACCTTGCACTATGCGTCAATCCAGAAAT
ACAGTATGTGAAGATCAA
Sequence Type mRNA
Unitrap ID UNI5493

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49782847..49788538 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es