Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0164
Clone ID DB0164
Vector pGT1lxr
Project sanger

Sequence tag DB0164
Sequence
CATGACACGTTTCCTGTCAAGATGGCGGATAATCTCCCTTCGGACTTTGATGTGATCGTAATAGGGACGG
Sequence Type mRNA
Unitrap ID UNI474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110299050..110299119 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025531 (Chm) NM_018818 choroidermia Gene [Source:MGI (curated);Acc:Chm-001]

 
Come back to gene ENSMUSG00000025531


For any suggestions or comments, please send an email to unitrap@crg.es