Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA071
Clone ID YTA071
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA071
Sequence
ACTTTCCCGCCAGCGGCGGCCGCGCGGTGGATGCGATCCTTGTAGGCGCTCGGAGCCGTGGCCCGGTCTGCCCGTCAGCC
TTCATCATGTCCCGACAAAGCACCTTGTACAGCTTCTTCCCCAAGTCCCCGGCACTCGGCGACACCAAGAAGGCCGCGGC
CGAGGCCTCACGCCAAGGTGCCGCTGCCTCTGGAGCCTCCGCTTCCCGCGGCGGGGATGCGGCCTGGAGCGAGGCTGAAC
CCGGGTCCCGGTCCGCGGCGGTATCCGCCTCGTCGCCGGAGGCAAAGGATCTCAACGGAGGGCTGCGGAGGGCCTCCTCC
TCCGCGCAGGCCGTGCCTCCCAGTTCTTGTGACTTCTCACCAGGTGATTTGGTTTGGGCTAAGATGGAAGGTTACCCCTG
GTGGCCTTGCCTAGTTTATAATCATCCCTTTGATGGAACGTTCATCCGGAAGAAAGGGAAATCTGTCCGTGTTCATGTAC
AGTTCTTTGATGACAGCCCAACAAGGGGCTGGGTTAGCAAAAGGATGTTAAAGCCATATA
Sequence Type mRNA
Unitrap ID UNI5508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88374403..88379727 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es