Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250991
Clone ID OST250991
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250991
Sequence
GACTGAGCACCATGTCTAAGGGACCTGCAGTTGGCATTGATCTCGGCACCACCTACTCCTGTGTGGGTGTCTTCCAGCAT
GGAAAGGTGGAAATTATTGCCAATGACCAGGGTAACCGCACCACACCAAGCTATGTTGCTTTCACGGACACAGAGAGATT
AATTGGGGATGCCGGCCAAGAATCAGGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATNGGGCGT
ANGTTTGATGATGCTGTTGATCATNTCTGATATGAAGCACTGGCCCTTNATGGTGGTGAATGATGCANGCAGGCCCAAGG
TCCAAGTGGAATACAAAGGGGAGACAAAAAGTTTCTACCCAGAGGAAGTGTCCTCCATGGTTCTGACAAAGATNANNGAA
ATTGCANAAGCGTACCTTGGAAAGACTGTTACCAACGCTNTGGNCACAGTGNCCGCTTNCTTCNATGACTCTTAGCNACA
GGCAACAAAAGATGCTGGAACTATTGCTGGCCTCAATGTACTTTGAATNATAAATGAACCAACTGNTGNTGCTATTGCTT
ATGGCTTATATNAAAAAGGTCGGAGCTGAAAGGG
Sequence Type mRNA
Unitrap ID UNI23630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40610003..40611071 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015656 (Hspa8) NM_031165 heat shock protein 8 Gene [Source:MGI (curated);Acc:Hspa8-009]

 
Come back to gene ENSMUSG00000015656


For any suggestions or comments, please send an email to unitrap@crg.es