Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250953
Clone ID OST250953
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250953
Sequence
TGAGTCTTTATAGTAAAAGCTGAAGGAAAAGTGGAATCAGATTTCTTTTGTCAATTAGGTCACNTTCAATCTCTTACTGG
AAGATTATTCAAAAGCATTGNCATCTTACCAGAGATACATACAGTTTACAGACTGACNTACTGGAAGAATGCTGCCTTTT
TATATGGNCTTGGTTNGGTCTATTTNTACTACAATGCATTTCAGNGGGCAATNAGAGCTTTNNNGGAAGCCCTTTATGTT
GACCCTAATTTTTGCAGAGCCAAAGAAATCCATTTACGACTTGGNTTTATGNTCAAAATGAATACAGATTATGAATCTAG
NTTAAAGCATTTTCAGCTGGCCCTGATCGACTGNAATGTCTGTACTTTGNNCAGNGTCGAAATNCAGTTTCATATTGNTC
ACTTATATGAAACCCAGA
Sequence Type mRNA
Unitrap ID UNI23633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 523217..576248 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]

 
Come back to gene ENSMUSG00000068457


For any suggestions or comments, please send an email to unitrap@crg.es