Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250886
Clone ID OST250886
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250886
Sequence
GAACTGAGCTCTTCCCACTGCAGACCGNCGGCCCCCTTACCATGCACCTTCCCTCAGAGTGATCCCAGGCTCCAGGGGGA
GCTAAGACCCTCTTTCTCCCCTTACCTATCCCCAGACTCTTCCACTCCATATAATACTTCCCTTGCTGGAGCCCCCATGC
CAGTAACCCACCTTTAACTGGCAGGGACNGCCCAGGGCCAACCCCACAGACCCCTACAGATCTCCAAGGAACCAGAATGC
ACACTAAACACAATTTTGTACAATTAAAACCATGTTTC
Sequence Type mRNA
Unitrap ID UNI23638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69469953..69470223 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041287 (Sox15) NM_009235 SRY-box containing gene 15 Gene [Source:MGI (curated);Acc:Sox15-001]

 
Come back to gene ENSMUSG00000041287


For any suggestions or comments, please send an email to unitrap@crg.es