Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250836
Clone ID OST250836
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250836
Sequence
GACTGAGAGTCTGGACTATGACCGCTGCATCAATGACCCTTACCTGGAGGTGTTGGAGACCATGGATAATAAGAAAGGGC
GAAGATACGAGGCGGTGAAGTGGATGGTGGTGTTCGCCATTGGCGTCTGTACGGGGCTGGTGGGTCTCTTTGTGGACTTT
TCCGTGCGACTCTTCACCCAACNTGAAGTTCGGAGTGGTTCAAACNGTGTATCCTTTCTACGGCTCCATTGTTTCAGACC
CTTTCATTCTCGAGGCTCTTTCTTGTTGAGAAATTTATCAGTAAATGTGGTATTTGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147400551..147403566 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029016 (Clcn6) NM_011929 chloride channel 6 Gene [Source:MGI (curated);Acc:Clcn6-001]

 
Come back to gene ENSMUSG00000029016


For any suggestions or comments, please send an email to unitrap@crg.es