Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250809
Clone ID OST250809
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250809
Sequence
AAAATTTCCTTACTAGATGACATTTCATCGCAATGTCCGATCGTTTGGGGCAAATAACCCAGGGCAAGGATGGGAAAAGC
AAGTACTCGACTCTCAGCCTGTTTGACAAGTATAAAGGGAGGTCAGTAGGCGCTGTCAGGTCCTCAGTTATTCCTAGACA
TGGCTTACAGAGTCTCGGGAAAGTTGCCACAGCCCGGCGTATGCCACCGCCTGCAAACCTGCCAAGCCTGAAGTCTGAAA
ACAAAGGAAACGACCCCAACATCGTTGATAGTTCCCAAGGACGGGACAGGATGGGCCAACANGCAGGACCAGCAAGACCC
AATGAGTTCCAGTGTGACGGNCTTTCAGNCGTCGNTAGTTCGCAGTCGCAGNCGGNTTTGNAGAAATCTGTCTCCAATTT
GC
Sequence Type mRNA
Unitrap ID UNI16587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32038000..32040938 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es