Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA039
Clone ID YTA039
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA039
Sequence
TTGTTGGGACACGCCGGCCAGACGTTTCTCAGCCAGCCTAGTTCTTCCCAGCGAAGAGCGGTTGTGTGGCCTCCATTGTT
CAGGATTAAGCGAGCCATGAGGGGTGACAGAGGACGTGGTCGTGGTGGGCGCTTTTGTTCCAGAGGTAGGGCCTGGTGGA
GGGTTCAGGCCTTTTGTGCCCCATATCCCATTTGATTTTTATTTGTGTGAAATGGCTTTTCCCCGGGTCAAGCCAGCACC
TGATGAGACCTCCTTCAGTGAAGCCTTGCTGAAGAGGAATCAAGACCTTGCCCCTAATTCTGCTGAGCAGGCTTCCATCC
TTTCTTTGGTGACAAAAATCAACAATGTGATTGACAACTTGATTGTGGCCCCAGGAACATTTGAAGTGCAAATTGAAGAA
GTCCGGCAGGTAGGATCATATAAAAAGGGAACAATGACTACAGGACACAATGTGGCTGACCTGGTGGTAATACTAAAGAT
CCTGCCAACAT
Sequence Type mRNA
Unitrap ID UNI5259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280067..90285388 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es