Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250574
Clone ID OST250574
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250574
Sequence
GACTGAGATGTCCCTGGTAGATTTGGGGAAGAAGCTTTTAGAAGCGGCACGAGCCGGTCAAGATGATGAAGTTCGCATTT
TGATGGCAAATGGAGCTCCTTTTACTACAGACTGGTTGGGAACTNNTCCANTTGATNTGGNCGCNCAGTATGGGCATTCT
CTCTANCACAGAGGTTTTTTTCNGAGCCGGNGTAAGTAGAGATGCCAGGACCAANGTGGACCGGACACCACCTGNACATG
GCGGCTTCTGAGGGCCATGCCAACATAGTANAAGTTTTGCTTAAGCATGGTGCTGACGTCAATGCAAAGGATATGTTAAA
GATGACAGCTCTGCATTGGGCAACAGAACATAATCATCAAGAGGTGGTGGAGCTTTTAATCAAATATGGTGCTGATGTAC
ACACGCAGAGTAAATTTTGTAAAACTGCATTTGATATTTCAATAGACAATGGAAATGAAGATTTAGCAGAGATATTACAG
ATTGCTATGCAGAACCAAATCAACACCAACCCGGAGAGTCCTGACACTGTGACAATACACGCTGCCACACCACAGTTCAT
CATTGGACCCGGAGG
Sequence Type mRNA
Unitrap ID UNI16680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126476262..126484315 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]

 
Come back to gene ENSMUSG00000027361


For any suggestions or comments, please send an email to unitrap@crg.es