Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250571
Clone ID OST250571
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250571
Sequence
ACTGAGTTTTTGGGAATAACGTTTCTTGGAATCGGACTGTGGGCGTGGAATGAAAAAGGCGTCCTACTCNANCATCNNGT
CCATCACCGNCCTCGNNGGCTTCAGACCCAGNGTGNCCTTGNTCCTTGTGGTTGGNAGGAGTGATGTNCATTCNTGNGGT
TGTNCAGGGTGCATNCGGAGCACCTTCTGNACNANACNGTTTCNTNTCAAGTTNTNTNGCTGTGCCCCTNGGGGATCATT
CTTTTTCTGGAACTCACCTGNTGGGNTGTNGGCNTTTGTNTTNAAANACNGGATNAAAGACCAGCTNNATTTCTTTATTA
ACAACAACATCAAGAGCCTACAGAGATGACATTGATCTACAGAACCTCATAGACTTCACCCAAGGAATAT
Sequence Type mRNA
Unitrap ID UNI22050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138531308..138557482 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028152 (Tspan5) NM_019571 tetraspanin 5 Gene [Source:MGI (curated);Acc:Tspan5-001]

 
Come back to gene ENSMUSG00000028152


For any suggestions or comments, please send an email to unitrap@crg.es