Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA133
Clone ID YTA133
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA133
Sequence
CATCTCTGCCAATGGTCACCCTCCTGGACGAATCTCTTGGCCCTCGAATGTGAATGGAAGTCACCGTGAAATGAAGGAAC
CAGGGTCCCAGCCGGGCACCACCACAGTTACCAGCTACCTCTCCATGGTACCTTCTCGCCAGGCAGACGGCAAGAACATC
ACCTGCACGGTGGAGCATGAAAGCTTACAGGAGCTGGACCAGCTGCTGGTGACCCTTTCCCAACCCTATCCACCTGAAAA
CGTGTCCATCTCTGGCTATGACGGCAACTGGTATGTTGGCCTCACTAACTTGACCCTGACCTGTGAAGCTCACAGCAAAC
CAGCGCCTGACATGGCTGGATATAACTGGAGCACGAACACGGGTGACTTTCCCAACTCTGTTAAGCGCCAGGGCAATATG
CTTCTAATCTCCACCGTAGAGGATGGTCTCAATAACACGGTCATTGTGTGCGAAGTCACCAATGCCCTAGGGTCTGGGCA
GGGCCAAGTGCACATCATTGTTAAAGAGAAACCTGAGAATATGCAGCAAAATACAAGATTACACCTAGGCTACATCTTTC
TTATCGTCTTTGTCCTCGCTGTAGTCATCATCATCGCAGCACTATACACTATACGAAGATGCAGGCAT
Sequence Type mRNA
Unitrap ID UNI5523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20494531..20502449 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040511 (Pvr) NM_027514 poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]

 
Come back to gene ENSMUSG00000040511


For any suggestions or comments, please send an email to unitrap@crg.es