Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250307
Clone ID OST250307
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250307
Sequence
ATATTGCTGTGGAAGACCTGAGCCCTGATCACCCAGTTGTTTTGGAGAATCATGTCGTGACAGATGATGATGAACCTGCC
TTGAAGCGCCAGCGACTAGAGATCAATNGCCAGGACCCCTCTATAAAGNCTTTCCTGTACTCTATTAACCAGACGATATG
TTNGCGGNTGGATAGCATTGAGGCCAAGCTGCAAGCTCTCGAGGCCACTTGCAAATCTCTGGAAGAGAAGCTAGACCTGG
NCACCAATAAACAGCACAGTCCCATCCAGGTCCCCATGGTGGCAGGTTCCCCACTTGGCGCCACCCAGACCTGCAACAAA
GTGCGATGCG
Sequence Type mRNA
Unitrap ID UNI21703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124498432..124502654 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es