Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250182
Clone ID OST250182
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250182
Sequence
GAGGACTGGACGGCAGCCCTGCTGAACAGGGGCCGCAGTCGGCAGCCCCTGGTGCTAGGGGATAACTGTTTTGCTGATTT
AGTTCACAATTGGATGGAGTTGCCTGAAGCAGA
Sequence Type mRNA
Unitrap ID UNI23660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107886844..107886954 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042106 (6230427J02Rik) NP_080873 RIKEN cDNA 6230427J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915426]

 
Come back to gene ENSMUSG00000042106


For any suggestions or comments, please send an email to unitrap@crg.es