Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250062
Clone ID OST250062
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250062
Sequence
ACTGAGCAAGGTTGAAGCATGGNAGCTGCGTGTGGGAAATANGTATCGCCTGGGCCGAAAGATCGGCAGTGGCTCCTTTG
GAGACATCTACCTGGGTGCCAACATTGCCTCTGGNGAGGAAGTAGCCATCAAGCTCGAATGTGTGAANACNAAACATCCC
CAGCCTCCACATNGAGAGCAAGTTCTACAAGATGATGCAGGGCGGGAGTGGGGATCCCGTCCATCAAGTGGTGCGGGGCT
GAGGGAGACTATAACGNGATGGNCATGGAGCTGCTGGGGCCCAGCCTGGAGGACCTCTTNAACTTCTGTTCCCGGAAGTT
CAGCCTNAAGACGGNGCTGTTGCTGGCCGACCANATGATCAGCCGCATCGAGTACATACACTCCAAGAACTTCATCCACC
GGGATGNGAAGCCCGACAACTTCCTCATGGGCCTGGGGAAGAAAGGCAACCTGGNGTACATCATTGACTTCGGCCTGGCC
AAGAAGTACCGGGATGCCCGCACACACCANNNTATTCCCTACCGGGAAAACAAGAACCTGACTGG
Sequence Type mRNA
Unitrap ID UNI18378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79256730..79269291 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022433 (Csnk1e) NM_013767 casein kinase 1, epsilon Gene [Source:MGI (curated);Acc:Csnk1e-001]

 
Come back to gene ENSMUSG00000022433


For any suggestions or comments, please send an email to unitrap@crg.es