Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST250008
Clone ID OST250008
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST250008
Sequence
CCAGCAAACACCATCAGATTGTGCATTTGGATCTGAGGAGCAGGCACCTGGACTCACTCAAGGCAATTGTTTTTAGAGAG
TATAATCAGACCTGTGAAANTTACAGCTCCACAACGTCTCTGCAGGAAGCGAGCCTTTCTATGTGTTNGGGATTCANAGA
TCACTCACGAAAACACA
Sequence Type mRNA
Unitrap ID UNI23666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 119458608..119461090 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031756 (Cenpn) NM_028131 centromere protein N Gene [Source:MGI Symbol;Acc:MGI:1919405]

 
Come back to gene ENSMUSG00000031756


For any suggestions or comments, please send an email to unitrap@crg.es