Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST249863
Clone ID OST249863
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST249863
Sequence
AACTTGGAAGAGACTGTCTGATCAATGCTGCTAAGACATCCATGTCATCCAAAATTATTGGAATAAATGGTGATTACTTT
GCTAATATGGTAGTAGATGCTGTGCTTGCTGTTAAATACACAGATGCCAGAGGCCAGCCTCGCTATCCAGTCAATTCTGT
TAATATTCTGAAAGCCCATGGGAGAAGTCAGATAGAGAGCATGCTGATCAATGGCGTATGCGCTCAATTGTGTGGTTGGA
TCTCAGGGCATGCCCAAGAGAATAGTTAATGCAAAAATTGCTTGTCTTGACTTCAGCCTGCAGAAAACAAAAATGAAGCT
TGGTGTACAGGTGGTTATTACAGACCCTGAGAAATTGGACCAAATTAGACAGAGAGAATCGGATATCACCAAGGAGAGAA
TTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGCATTGATGATATGTATCTCAAGTATTTTGNG
GAAGCTGGTGCCATGGCTGTTAGGAGTCAAGGC
Sequence Type mRNA
Unitrap ID UNI23667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13112728..13115100 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es