Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA182
Clone ID YTA182
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA182
Sequence
AACGACCCCCTCTCCCTAAAAGGAGTTGGGTTGGGGGGAAATGAAAAATGAGTTTGTTTTTTTTTTTTTTAAAAGAGACT
TTTTGATCCAATGAGGCCCCACAAGTAAATGAGTTTGGGTCCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTAC
CCCTCCCCCCTGAGCCCGAGGTGCTGACGTCGCAAAAAAATTGGATAAAGCCACCATCATGGGTTCAGGTCCCATAGACC
CCAAAGAACTGCTCAAGGGCCTGGATAGCTTCCTTACCCGGGACGGAGAAGTGAAGAGTGTGGATGGAATTTCCAAGATC
TT
Sequence Type mRNA
Unitrap ID UNI5538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054455..36060367 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es