Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST249798
Clone ID OST249798
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST249798
Sequence
GTCTGTCTAGCATGGTTGAGATGGAGCAGGCTGAGGCCCAGCTCTCCGAGTTGGACCTCCTGGCCAGTATGTTCCCCAGT
GAGAATGAGCTCATAGTGAATGACCAGCTGGCATTGGCGGAGCTGAAAGATTGTATTGAGAAGAGGACAATGGAGGGGCG
ATCATCGCAAGTGTACTTTACGATCAATGTGAGCCTGGACCTCTCTGAGGCAGCAGTGGTGACGTTTTCTTTGTCTTGCA
TTCTTCCCTTTAAATATCCTACAGTCCTGCCCGAAATTACAGTGAGATCAGTATCGCTGAGTAGATCCCAGCAGACTCAG
CTGAACACAGATCTGATAGCATACCTGCAGAAGAACTGTCTTGGAGATGTCTGTATCCTGAATGCCACAGAGTGGGTTAA
AGAGCATGCCTTTGACTATGTCAACATAGAAGCTTTGCCCTCCCCCGCCAGGCAAAGCACAGCCCAGCCAGAGGATCTCG
CTTTCACGAGGCTCTGGATCTACAGCCATCACATCTACAACAAGTGCAAAAGAAGAAACATCCTAGAGTGGGCAAAGGAA
TTGTCCCT
Sequence Type mRNA
Unitrap ID UNI17406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 87436899..87437757 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041079 (Rwdd2b) NM_016924 RWD domain containing 2B Gene [Source:MGI (curated);Acc:Rwdd2b-001]

 
Come back to gene ENSMUSG00000041079


For any suggestions or comments, please send an email to unitrap@crg.es