Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA163
Clone ID YTA163
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA163
Sequence
TGGCCTTTAACCAGGAGACAGGCCACTGGGAACGCATTTATACCCAGTCCAGCTGATCTGGAACTGTATCACAGGAGGCC
TTACATCAAGATATGCATGAAGAAAGCTGTGAGGAAGACTCCCTCAGGAGGAGGTTGCTGGAGTCTTCCCTCATTTCATT
ATCCCCTTATGATGGAGCAGGATCCAGAGAGCACTCAATTTACCCAGACCCAGCGAGATTATCTCCTGCTGCATACTACG
CCCAGAGGATGATCCAGTATCTCTCAAGGAGAGACAGTATTCGCCAGCGCTCCATGCGCTACCAACAGAATCGGCTTCGT
TCTTCCACCTCCTCTTCTTCCTCAGACAACCAGGGTCCATCAGTAGAGGGAACCGACTTGGAATTTGAGGACTTTGAGGA
CAATGGTGACAGATCTAGGCACCGAGCTCCCCGAAATGCCCGAATGTCTGCACCTTCACTTGGACGATTTGTTCCAAGGC
GTTTTTTGCTGCCTGAGTACTTGCCTTATGCTGGGATTTTTCATGAACGTGGACAGCCTGGCTTGGCTACTCATTCTTCT
GTTAACAGGGTCCTGG
Sequence Type mRNA
Unitrap ID UNI5541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91613775..91665506 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es