Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST249491
Clone ID OST249491
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST249491
Sequence
GACTGAGATGATGACGAACATGAGTGGNTTGTCAGGCACCTGCCGCAAGGGCTGGTTGCCAATGCCCAAACAGAAGTCCT
AGCCATGAGCACCTCGGCCTCAGCATCTCACCAGGGACTTCCTTCTGCCCACTGCTGGCCTGGGAAACTGGCTGTAGTCC
TAGCTTCGACTTAAGTTTCAGAATAAAGGTTTTCTGCACTGAACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35125791..35935231 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026894 (Morn5) NM_029309 MORN repeat containing 5 Gene [Source:MGI Symbol;Acc:MGI:1922745]

 
Come back to gene ENSMUSG00000026894


For any suggestions or comments, please send an email to unitrap@crg.es