Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSJ336
Clone ID CSJ336
Vector pGT0Lxf
Project baygenomics

Sequence tag CSJ336
Sequence
AGAATGAGTTGGGTTGGCAGAGACGGAATTATTATCAAGCGGAGGACGACCCTGGTCGAGAGCAGACCGGGCTAGAGGCC
CACTCTTTGGGACTGGACACAAGAAGTTATTTCACGGAGTTACCAAAAGCGCAAACAGCCCATGAGGGGGCCCTGAATGG
AGTAACCTTTTATGCCAAGCTGCAGGCTGAGGATGGACACTGGGCTGGTGATTATGGGGGTCCGC
Sequence Type mRNA
Unitrap ID UNI5549

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75994663..75996381 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033105 (Lss) NM_146006 lanosterol synthase Gene [Source:MGI Symbol;Acc:MGI:1336155]

 
Come back to gene ENSMUSG00000033105


For any suggestions or comments, please send an email to unitrap@crg.es