Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST249438
Clone ID OST249438
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST249438
Sequence
CTGAGTGAAGAGAAGGAGGAAGTGACCATGGNCACCAGTGAAAACAGACCTGAAAATGAGGTGCCTGAGCCTCCTCTGCC
TGTTGCAGACCAAGTCAGCAATGATGAGCGCCCAGAGGGCGGTGCTGAAGAAGAGGAAAAGAAAGAGAGTTCGATGCCCA
AGTCATTCAAGAGGAAAATCTCCGTTGTCTCAGCTACCAAGGGGGTGCAAGCTGGAAACAGTGACACAGAGGGGGGCCAG
CCTGGTCGAAAACGCCGTTGGGGAGCCAGCACTGCTGCGACACAGAAGAAACCGTCCATCAGTATCACCACTGAGTCACT
CAAGAGCCTCATCCCCGACATCAAACCCCTGGCGGGGCAGGAGGCTGTTGTGGATCTTCATGCCGATGACTCCCGAATCT
CTGAGGATGAGACAGAGCGTAATGGCGACGATGGGACCCATGACAAGGGACTGAAGATATGCCGGACAGTCACTCAGGTA
GTACCCGCAGAGGGCCAGGAGAATGGGCAGAGGGAA
Sequence Type mRNA
Unitrap ID UNI23678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55264542..55270697 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es