Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA199
Clone ID YTA199
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA199
Sequence
AAAGTGAAAAAAAATGCAGAATATCCTGTAAACTTGGCAGTTGAAGACCTACAGAAGCGTCCTGATCAGACATGGGTTCA
ATGTGACGCTTGTCTAAAGTGGCGAAAGTTACCAGATGGGATAGATCAGCTTCCAGAAAAATGGTATTGCTCCAATAACC
CTGACCCACAGTTCAGAAACTGTGAAGTTCCGGAAGAACCTGAAGATGAGGATTTAGTGCATCCTACTTATGAGAAAACC
TATAAAAAGAC
Sequence Type mRNA
Unitrap ID UNI5554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93860790..93862960 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es