Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA204
Clone ID YTA204
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA204
Sequence
GGCCGCGGCGGCTGGTGTGGGGTTGAGTCAGTTGTGACACCCGGAGCTGCTGAGCGGACAGGCTGCCCTCGGGACCCCCG
CGGCCCGGCAGCAGGCGCGGAGCTTCGGGAATCGTGAGCCTGGCCCCGTCCTAGAGCTCCGCGGAGCCGGCGCCGCCACC
GTCCCCTCGCCCCCGCCAGCGAACCGCCGCCGCGGGCGCGCCCCCGCTCTGCGCTGCGCTGTCTCCTATGGCGTCCGCCT
CCGGGGCCATGGCGAAGCACGAGCAGATCCTGGTCCTCGACCCTCCTTCAGACCTCAAATTCAA
Sequence Type mRNA
Unitrap ID UNI416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65962562..65962865 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024091 (Vapa) NM_013933 vesicle-associated membrane protein, associated protein A Gene [Source:MGI Symbol;Acc:MGI:1353561]

 
Come back to gene ENSMUSG00000024091


For any suggestions or comments, please send an email to unitrap@crg.es