Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST249279
Clone ID OST249279
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST249279
Sequence
TTCTGCCCAGCCAGTGACAACTGTGGACTGACTCTAGAATGTTCCTTAGTAGAACAAGAGGAGCTGCCCGTTCTTTATGT
AGGGCATGGAGGTGAAGAAAGCAGCGCAAACAACACATCGTCAGTGGGAGAAACCATGTTGTCATCAATGAGAGAAACCA
AGTCAGCAGCCTGAGGTGGAGGAAGCACCTTCCCCTGAAGACAATGTCTATNNNGGAACTACTAGTGACGATTCGGATAT
TGTTACACTTGAACCACCTAAGCTGGAAGAAATGGGGAACCAGGAAGTTACAATTCAAGAAGCGCCCAGCTCAGATGACC
TTAACATGGGCTCTTCCTCCAGCAGCCAGTACGCCTTCTGCCAGCCAGAACCCGGNATGGAGCTGTGGCAGCAGCGAACC
TCTGACGTCTTACTTTACTTAATGGCTTGTTCTCTAGCTCCAGCTTTCAATGTCTTAAATAATTTTTCTGAAACTCAANA
AAATTTGGATAAAATTTGTTACAGTGTTAAA
Sequence Type mRNA
Unitrap ID UNI21882

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72846854..72849816 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es