Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA244
Clone ID YTA244
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA244
Sequence
GACCCAACATTCGTGCCCCATCTGCCAGAAGAAATTCACCAACGCCGTCATGTTACAGCAGCATATCCGGATGCACATGG
GTGGCCAGATCCCCAACACCCCTCTGCCAGAGAGTCCCTGTGACTTCACGGCTCCCGAGCCCGTGGCCGTCAGTGAGAAT
GGCAGTGCCAGCGGGGTCTGCCAGGACGACGCAGCAGAAGGGATGGAAGCCGAGGAGGTCTGTTCTCAGGATGTTCCCAG
TGGCCCCTCAACTGTCTCTCTGCCGGTTCCCAGTGCCCACCTGGCATCGCCCTCTCTGGGCTTCTCTGTGTTGGCCTCCC
TGGATACGCAGGGGAAAGGGGCTCTTCCGGCGCTGGCCCTGCAGAGGCAGAGCAGTCGAGAAAACAGCTCCCTGGAGGGC
GGTGACACTGGTCCAGCCAATGACTCTTCCTTGCTCGTGGGTGACCAGGAGTGTCAGAGCCGAAGCCCAGATGCCACGGA
GACCATGTGCTACCAGGCAGTGTCACCCGCCAATAGCCAAGCCGGAAGTGTCAAGTCCCGGTCTCCCGAGGGTCACAAGG
CCGAGGGCGTGGAGAGCTGCCGCGTTGACACCGA
Sequence Type mRNA
Unitrap ID UNI5565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168579936..168580529 592
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es