Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST248767
Clone ID OST248767
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST248767
Sequence
GACTGAGGCTTGATTTAAATTTGGATGAGGATTATTCTTGCATCAAGTATGTTAATAAGCCAAAATTTANGCTTCTAATG
TGAGGAAAAACATGGAATGACAAGTGTGGGAAAGAGCAAGCACTAAATTACTGTCAGAAAAATAAACGGAGCAGCACAGT
GGTGCCTCCGTGATTTACGGGGGCAATTAGTCACCACCCCACAGCGCTGCTGAGGACGGCCTGGCAGCAGACACATCAGG
CCCACGAGGAGGAAGAGGCTCTGCACTAAGCTCCAGATGACTCTTCAAACAAGAGCAAGTCCGTGAGCACATGAGAGTCT
GTGTGTTCATTCTGGGTGTCTACCCTTCACACTCCCCACCAGCTTGATAAATAAACAGACTTTTCGTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 106986757..107095866 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]

 
Come back to gene ENSMUSG00000049606


For any suggestions or comments, please send an email to unitrap@crg.es