Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA258
Clone ID YTA258
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA258
Sequence
CGCGGGCCGTTGGGAGCGGGAGAGGCGGAGGCGGCCCGAGGCCAAAGCACCCGCCAGGCGCCGAGGGGAATATGAAACAG
GTGTCAAAATGACATCCAGATTTGGAAAAACTTACAGTAGGAAAGGAGGAAATGGCAGTTCAAAATTTGATGAAGTTTTT
TCCAACAAACGGACTACTCTTAGTACAAAATGGGGTGAGACCACATTTATGGCTAAATTAGGGCAGAAGAGGCCCAATTT
CAAACCAGATATTCAAGAAATTCCGAAGAAACCTAAAGTAGAAGAAGAAGATACTGGAGATCCCTTTGGTTTTGATAGTG
ATGATGAGTCTCTACCTGTTTCTTCAAAAAATTTAGCCCAGGGTAAGGGTTCATCTTACTCAGAATCTAGTGAGGCTGCT
CAGCTGGAAGAAGTCGCTTCTGTATTTGAAGCTAATAGCAAATGTAGTCATGTGGTGGGTGAAGACAGTTTTGCTTCCGC
ACAGATGCTTATTTGTGGAGGATACTTTAATTGGGAAAGAGAAGAGCATAAGTAGAATTCCAGAAGACAACGCAAACAAA
TGTAGTTGCACTAAGTCGCTAACTT
Sequence Type mRNA
Unitrap ID UNI5570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35487481..35490657 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es