Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST248627
Clone ID OST248627
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST248627
Sequence
TGCCTCATGATGAAGATTCTTCCGATGACATTGCNTGTAGGTCTAACGTGCCAGCACGTNAGTTNTGCTGTCAGNGTGAN
TCATGNGAANAAAGCAGTNNCTGAGAGTCTGTGGNCNGTTTGTTCAGAATGTTTGAAAGAGAGAANATTCTGCNATGGAC
AGNCAGTACTGCCTGCTGATGTTTGGTTGTGCCTCAAGTGTGGNTTGCAGGGATGCGGTAAAAACTCANAAAGCCAGCAT
TCACTGAGACACTTCAAGAGCTCTGGGACAGAGTCCCATTGTGTTGTCATCAGCCTGAGTACATGGGTCATATGGTGTTA
TGAATGCAATGAAAAGNTGTCNACACATTGCAACAAGAAAGTTTTGGCTCAAATAGTNGATTTTCTCCAGAAACATGCTT
TTAAAACACAAACAGGTAACTTAAGCANTTTGTGAAAGCAATATGGATTAAAATACAACATTTCATACTTTGCCTGAAAA
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI23702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21707562..21712005 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040455 (Usp45) NP_690038 ubiquitin specific petidase 45 Gene [Source:MGI (curated);Acc:Usp45-001]

 
Come back to gene ENSMUSG00000040455


For any suggestions or comments, please send an email to unitrap@crg.es