Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA261
Clone ID YTA261
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA261
Sequence
TGCTCTTCGCTGCTACTGTAGGTGCCGCGCTGTCGGCGTTCGCTGCTCCTGGAAAAGCCCGAGCCGCGACACCGCCGGCC
TTAGCGCTGCGCTGCCCGGAACCGCCCCTAAAGAGGAGACCCGGGGCGGGGTCGCGCCTCGGGCCTCCGCTGCGGTCCCC
GGCAGGCGGGAGCCGGCGCTGCGGGGCCTGCGGCGGAGCGCGATACCCCTCCCCGGCCGCCCTGTCTACCTTGCCGGGGA
AGGCGGAAGATGCCAGTGAAGAAGAAGAGAAAAGCTCCCGGAGTGGCAGCGGCGGTCGCGGAAGACGCGGGCCTCAAAAA
GTGTAAAATCCCCAGCTATTGCAGATCCCAGCCTCCTGCTAGACTCATCAGTGGAGAGGAAGATTTTTCAAGAAAGAAGT
GCCCGGCTTGGTTTTATGAGTATG
Sequence Type mRNA
Unitrap ID UNI5579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7184548..7186856 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032002 (Dcun1d5) NM_029775 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924113]

 
Come back to gene ENSMUSG00000032002


For any suggestions or comments, please send an email to unitrap@crg.es