Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA267
Clone ID YTA267
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA267
Sequence
AGTGTCTGGTTTGGCGGCGGAAGCATTGGCGGGCTGTGTGAGTCTGTGAGTGGAAGGCGCGCCGGCTCTTTTGTCTGAGT
GTGACCCGGTGGCTTTGTTCCAGGCATTCCGGTGATTTCCTCCGGGCAGTCCGCAGAAGCCGCAGCGGCCGCCCGCGCTC
TCTCTGCAGTCTCCACACCCGGGAGAGCCTGAGCCCGCGTCACGCCCCTCAGCCCCCGCTGAGTCCCTTCTCTGTTGTCG
CGTCCGAATCGAGTTCCCGGAATCAGACGGTGCCCCATAGATGGCCAGCTTTCCCCCGAGGGTTAACGAGAAAGAGATC
Sequence Type mRNA
Unitrap ID UNI5578

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79067856..79068174 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017677 (Wsb1) NM_019653 WD repeat and SOCS box-containing 1 Gene [Source:MGI (curated);Acc:Wsb1-001]

 
Come back to gene ENSMUSG00000017677


For any suggestions or comments, please send an email to unitrap@crg.es