Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST248456
Clone ID OST248456
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST248456
Sequence
AGGCTGACAGAGACACCTACAGAAGGAGCCGCTGTGCCCCCTGGAGCTGACAAGAAAGCTGAGGCTGGGGCTGGCTCAGC
CACTGAGTTCCAGTNTAGAGGCGGCTTTGGTCGTGGACGTGGTCAGCCACCTNAGTGAAGTTGGAGTTTATGTTGTATTG
AATAAACTTTAAAGAAAAACAAA
Sequence Type mRNA
Unitrap ID UNI14930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27767367..27769262 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es