Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA259
Clone ID YTA259
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA259
Sequence
GAAGTTCCGTTGGGGAAGATGGCGGCGGCCGCGAGCACCCTTCTCTTCTTGCCGCCGGGGACTTCAGATTGAGCCTTCCC
CGGAAGAGTCGGGGCCGCTGGTGCGCCGCTTCCCCGGAGCCCAGGCTAACTTGGTTCCCCTCTGAGTGGCGGGGAAAGGC
TCCCCGGCTCGTGGCGGACCCAAGACCTCCCCGCTGTCAGGATGAAGGCTCAGGGGGAAACCGAGGACTCAGAGAGGCTG
AGTAAGATGAGCTCCCTCCTGGAACGGCTCCATGCAAAATTTAACCAGAACAGACCTTGGAGTGAAACCATTAAGTTTGT
GCGTCAAGTAATGGAGAAGAGGGTCGTAATGAGTTCTGGAGGGCATCAGCATTTGGTCAGCTGTTGGAGACATTGCAGAA
GGCTCTCAA
Sequence Type mRNA
Unitrap ID UNI5583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98045158..98054598 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es