Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA276
Clone ID YTA276
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA276
Sequence
GGCCGGTGGCAAGCCCCCTGGAGGGAGCCGCAGTAGTACGACGAAAGATGGCGACGAGCGGCGGCGAAGAGGCGGCGGCA
GCAGCTCCAGCGCCCGGAGCCCCGGCGACCGGGCAGGACACGACCCCGGGCTGGGAGGTGGCGGTGCGGCCCCTCCTGTC
CGCGTCCTACTCCGCCTTCGAGATGAAGGAGTTGCCGCAGCTGGTGGCCTCAGTCATCGAGAGTGAGTCAGAAATCCTGC
ACCACGAGAAGCAGTACGAGCCGTTCTACTCCTCCTTTGTCGCACTGTCCACGCACTACATCACCACGGTCTGCAGCCTC
A
Sequence Type mRNA
Unitrap ID UNI5587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138936556..138944380 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066036 (Ubr4) ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI (curated);Acc:Ubr4-001]

 
Come back to gene ENSMUSG00000066036


For any suggestions or comments, please send an email to unitrap@crg.es