Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA280
Clone ID YTA280
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA280
Sequence
GGTTGGTGTTGGCGGGAGCCGGGTGGGCCGGCTGCCTGGTGTTCTTTGCTGTGCGACCCGGGCTGCAGGTGCTCCGGGGT
GTTGCTGTTGAGTTCCGCGGCCCAACGTCACGATGAGGGTGGCCGTGGCCGGCTGCTGCCACGGCGAGCTGGACAAGATC
TACGAGACTCTGGCGCTGGCGGAGCGGCGCGGCTCGGGACCCGTGGATCTCCTTCTGTGCTGCGGCGACTTCCAGGCGGT
GCGCAACGAGGCCGACCTGCGCTGCATGGCCGTGCCGCCCAAGTACCGTCACATGCAGACCTTCTACAGATATTACTCTG
GAGAGAAAAAGGCCCCGGTTCTCACCATCTTCATTGGAGGAAACCATGAAGCCTCAAACCATTTGCAAGAGTTACCCTAT
GGTGGCTGGGTAGCGCCGAATATTTATTATTT
Sequence Type mRNA
Unitrap ID UNI5588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99476236..99477117 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032469 (Dbr1) NM_031403 debranching enzyme homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1931520]

 
Come back to gene ENSMUSG00000032469


For any suggestions or comments, please send an email to unitrap@crg.es