Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST248083
Clone ID OST248083
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST248083
Sequence
TTCCAGGTACAGTGANGNAGCTGGTTCCGTTCCCTCTTTGTCCACAAGGTGGATCCTCGGAAGGACGCCCACTCCACTCT
GCTGTCCAAGAAGGAGACTAGTAATCTCTACAAGATCCAGTTTCACAACGTGAAGCCCGAATGTCTGGATGCCTACAACA
GTCTGACGGAGGGCTGTACTGCCCAAGCTGCACCTGGATGAGGACTATCCCTGCTCGCTTGTGGGCAACTGGAACACGTG
GTACGGGGAGCAGGACCAGGCAGTACACCTATGGCGGTTCTCAGGTGGCTACCCGGCCCTCATGGACTGCATGAACAAGC
TAAAAAACAACAAGGAGTACCTGGAGTTCCGGAAGGAACGGAGCAAGATGCTGCTGTCCAGGANAAACCAGNTGCTTCTG
GAGTTCANCTTCTGGAATGAGCCACAGCCCCGAGCTGGNCCCCAATATNTATGAGCTGAGGACATATAAACTCAAGCCAG
GAACCATGATTGAATGGGGAAACAACTGGGCTCGGGNCATCAAGTACCGGCAGGGAGAAACCANGAGGCGGGGGGAGGCT
T
Sequence Type mRNA
Unitrap ID UNI23715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4783377..4789945 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]

 
Come back to gene ENSMUSG00000034285


For any suggestions or comments, please send an email to unitrap@crg.es