Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST247912
Clone ID OST247912
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST247912
Sequence
GAAGCTGCAAGGTCACNCATTTCTGAATCATNGGAGCAGGAACANTAAACNAGAGAAAATGGTGTTACAGATGACCTGGG
ATGCTCCCAAGCCCAAAAAAGCTAAAATGAGAGAAAAGCTAAATGGAGACACCAANGAAGGACTTAGATTTTCAGATGAA
TTCTCCCCATCTCATAAGTCAAGAANAAAAGACCTGCCNAATGGAGATGTGGATGAGTATGAGAAAAGGTCAAAGCGAGT
GTCATCCTCAGAAAACTCTCACAAGTCANGCGATNAAGCAGAGGAGACTCTAACACGTGAACAAAAGGAAGGAGCCTTCT
CTAATTTCTCCATTTCTGAGGAGACCATAAAGCTTCTGAAAGGTCGAGGGGTAACATATCTCTTTCCTATTCAAGTTAAA
ACCTTTGGTCCTGTNTATGAAGGAAAAGATTTAATTGCTCAANCCCGGACAGGAACAGGAAAGACNTTCTCTTTTGCCAT
ACCCTTGATTGAAAGGCTCCAAAGAAAACAAGAAACANTTCTGTTTGCCGTCNCCCTNNGGTACTTCGGTTTGGCTCCAA
CAAGGGAAC
Sequence Type mRNA
Unitrap ID UNI23718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62103584..62109933 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020076 (Ddx50) NM_053183 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Gene [Source:MGI Symbol;Acc:MGI:2182303]

 
Come back to gene ENSMUSG00000020076


For any suggestions or comments, please send an email to unitrap@crg.es