Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0054
Clone ID DB0054
Vector pGT1lxr
Project sanger

Sequence tag DB0054
Sequence
AATGAGCCCAGTGCTGACCCAGAGACTGTTATTGGAAAGTCATCAGATCATAAAGTGATGGAAGTGACATTTCAAGGAGA
ATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATTCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCTTATG
AGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTCACATTCTAAAACCTGGGACTACTGAGAGTGGAGCCTTATCCTTG
GACCCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGA
AATAGAAAATCAAAATCCCCTGGCCTCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCC
TAGAAAGGAATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTATATGG
AATTTGCAGAAGCAAG
Sequence Type mRNA
Unitrap ID UNI483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77506294..77519043 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es