Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA319
Clone ID YTA319
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA319
Sequence
ACCTGCGACAGATAGTCCTGGGCTGCCAGTACCTGCACCGCAATCAGGTCATTCACAGGGACCTCAAGCTGGGCAACCTC
TTCCTGAACGAGGATCTGGAGGTGAAAAT
Sequence Type mRNA
Unitrap ID UNI5275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 129304108..129304216 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030867 (Plk1) NM_011121 polo-like kinase 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97621]

 
Come back to gene ENSMUSG00000030867


For any suggestions or comments, please send an email to unitrap@crg.es