Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST247749
Clone ID OST247749
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST247749
Sequence
GGTCCCAGTCCGGACAAGAATGTCCAGCTCCNGGAAAACNAGATCCGAGGAACTCTGCCTGAANTTCTCGGGGAGGATNT
TCCTCANTCAGCCTATCCTTTNAAAACTNGTANCACCACTCAGGGACATGNGGNGACATCCACGGGGCAGNACGTATGAT
TNGCTCCGNCTGTNNGAANANGGNGGCTTTCCTCCANAGAGCAACTATTTGNTTCTCGGGGACTATGNGGACAGGGGCAN
GCANTCCCTGGAGACAATCTGCCTCTNGCTGGCCTACNNANTNANGTATCCGGAGAACNTCTTNCTTNTCACAGGGAANC
NCGAGTGCGCCNGNATCAANAGGNTCTACNGNTTTTATGATGAGTGGAAAAGAAGATNCNNCATTNNGCTGTGGAAANCG
TTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGNNGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCAC
CAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGG
Sequence Type mRNA
Unitrap ID UNI23724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122618190..122622813 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es