Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA340
Clone ID YTA340
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA340
Sequence
GACGCGTCGTGGACGTTGGGGAGCGGGAAGGCAGCAGCAGCGAGGCCGGGATGAACAGCGGCGGCGGCTTCGGCTTGGGC
TTAGGCTTCGGCCTCTTCCCTACGACGGTGATTCAGGTGACGAACCTCTCGTCGGCGGTGACCAGCGAGCAGATGAGGAC
GCTCTTTTCCTTCCTAGGAGAAATCGAGGAGCTACGGCTCTACCCCCCAGACAATACACCTCTTGCTTTTTCCTCCAAAG
TATGTTATATTAAGTTTCGTGACCCATCAAGTGTTGGTGTGGCCCAGCATCTAACTAACACGGTTTTTATTGACAGAGCT
CTGATAGTAGTTCCTTGTGCAGA
Sequence Type mRNA
Unitrap ID UNI59

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104559399..104564589 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032621 (Sfrs12) NM_172592 splicing factor, arginine/serine-rich 12 Gene [Source:MGI Symbol;Acc:MGI:2145245]

 
Come back to gene ENSMUSG00000032621


For any suggestions or comments, please send an email to unitrap@crg.es