Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA332
Clone ID YTA332
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA332
Sequence
GCATCCACCAAGATGCTGGAGAGATTTCCTAACAACCTGCCCAAACATCGAGAAAATGTGATTCCTGCTGATTCAGAAAA
AAGGAGCTTTGAGGAAGTTATCAACATAGTTGGCCAGACTTCAGACAACACACCGACCACCGTATCTCAGGATGTGGAGG
AGAAGCTCGCTCGCGCCCCTGCCAAGCCTGAGGCCCCCGTGGACTCCATGCTCAAGGACATGGCTACCATTATCCTGAGC
ACCTTCCTGCTGGTTGGATGGGTGGCGTTCATCATCACTTACCCCCTGAGCGTGCATCAGCAGCGTCAGCTCCAGCACCA
ACAGTTCCAGAAGGAGCTGGAGAAGATTCAGCTCCTGCAGCAGCAGCAGCTGCCCTTCCACCCACACGGAGACCTTACCC
AGGACCCTGAGTTCCTGGATTCATCTGGCCCCTTCTCAGAGAGCTCTGGCACCAGCAGCCCCAGCCCATCCCCCAGAGCC
TCCAACCACTCCCTCCACCCCAGCAGCTCTGCCTCCAGGGCCGGCACCAGCCCCTCTCTGGAGCAGGATGATGAG
Sequence Type mRNA
Unitrap ID UNI5601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106271210..106275760 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020715 (Ern1) NM_023913 endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI (curated);Acc:Ern1-001]

 
Come back to gene ENSMUSG00000020715


For any suggestions or comments, please send an email to unitrap@crg.es