Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST247037
Clone ID OST247037
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST247037
Sequence
CTCAAGAAGTGATCCCAAGGTGGAGAATGAGAAGTGCTGATCTTGGAACAGACAAGCTGTTATGATACAAACTCTGCCTG
CAGCCACTACTGANATGAGTCATCNCCTGTGTATTTGGCTTTTTCGGAATCCATTTCTCCGTGCGTGCCCCCAGAGACAT
GTCTTCCTTTCTTGTCAGCAGNTCCGACAGATAAGCCTTGATACAAGGCCGNGGAATTTTAGACAAAAGAAGACTCATGT
TCTCTATCAGCTCTTAAACAAGAGTTGGTCCAGGGGCTGCTGTCATCAAGGCACAAGGAAGCTTTGGAAACACAAAGCCC
TACAGAAGTATATGGAAGACCTGAATAAAGAGTACCAAACCCTTGACCAGTGTCTGCAGGGTATCTCTGAG
Sequence Type mRNA
Unitrap ID UNI16243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79799521..79801533 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022022 (Mtrf1) NM_145960 mitochondrial translational release factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384815]

 
Come back to gene ENSMUSG00000022022


For any suggestions or comments, please send an email to unitrap@crg.es