Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST246770
Clone ID OST246770
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST246770
Sequence
GACTGAGGGGGCAGATGGCCTGTNGGTNCCCGAGGGCATNTCTNTGAAACNCGTTGNTGNGGCGGAAGATTGCTTTGNCN
TCATCTACTCGATGCACGTNGAGAGCTCTGCNGAGCCAGGCAAAGCCCCCAAGCACGCTGGGCATGAAGAAAACCTACCG
AGCGATCGCGGAGACCTACGCCTTCCTCCCCAGAGAGGCTGNGACTCGGTTCCTCATGAGCTGCACGGAATGCCAGAAGA
GGATGCACTTTAACTCCAGCGGCCCGGAGCCCAAAGAGAATGAGCCTCCATCCCCTCTGGTGTCTGGCATTATTGATTAC
AACATGCCCCTCACCTCTACCTACTTGAAGCAGATGAAGCTGCGAGTGATGAACTCTCAGGAGCAGGCNCNGGNCNGGCT
CTCTCNCNNAGAANCNAACACGTTGTANTNGCNGTGGATGGAGGCTGAGAAT
Sequence Type mRNA
Unitrap ID UNI16200

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153296362..153309580 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061411 (8430427H17Rik) NP_001127772 RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]

 
Come back to gene ENSMUSG00000061411


For any suggestions or comments, please send an email to unitrap@crg.es